GUYS. GUYS.

waywardbard:

SPONSORED POSTS ON YOUR DASH?

HAVE TUMBLR SAVIOR?

ADD “/sponsors” TO YOUR BLACK LIST.

PROBLEM SOLVED.

*don’t log on to Tumblr for about a week*

*log back on only to find f-ing Sponsored.Posts. on my dashboard*

Thank the heavens for Tumblr Savio(u)r; it almost started to become completely not worth it to view my dash (I have enough updates already without unwanted posts popping up as well. Let’s keep the ads to the sidebar, ok lads?)

Welp. I wonder what else’ll happen after that Yahoo merge. :|

(also: in case the shit storm about this was already days ago, my apologies for posting about this now. But as said before, I have been afk for a while so I have no idea about what’s going on here anymore. :’D)

Tibet Festival in Arlington, VA, June 22!

To everyone near Arlington, Virginia: There’s a special Tibetan festival coming to town in about 2 weeks time.

(Aaah, why does all the cool stuff always have to happen at the other side of the Atlantic?! :c )

I’ve been supporting International Campaign for Tibet for about 6 years now. Lately the support has become even more necessary since China has increased its grip on the area and the Tibetans are suffering from some very grim oppression.

Err, the Tibet Fest is a bit lighter in spirit though:

"Tibet Fest is a family-friendly event inspired by Tibetan Buddhist culture and the global concern for its survival inside Tibet. Attendees will have the opportunity to experience and explore the rich traditions of Tibet through an afternoon of activities for the whole family — from making prayer flags, to sending His Holiness the Dalai Lama a birthday card. There will also be a Tibetan market providing the chance to take home a piece of Tibetan culture"

Read more here: http://action.savetibet.org/o/6063/t/0/blastContent.jsp?email_blast_KEY=146367

I don’t blog much about these things, but I thought this would be a nice opportunity to learn a bit more about the culture and the country for everyone who’s interested.

And if you know any followers of yourself who might like this, please share!

Why did dinosaurs evolve feathers?

"Dinosaurs evolved feathers long before birds came on the scene, but why if they couldn’t fly? Dr Dave Hone explains"

Very well written article about the plethora of other uses feathers could have had in early, non-avian, feather-bearing dinosaurs.

Read more here: http://www.guardian.co.uk/science/lost-worlds/2013/jun/05/dinosaurs-fossils

I curse him for the joke made at the start though:

"I for one would love to see a flying tyrannosaur"

Holy Jesus, that is actually a pretty scary mental image, stuffofnightmaresgoaway. D8 

Best Google Doodle ever? Best Google Doodle ever.

Happy birthday Julius Richard Petri!

(via mariam-alpha-deactivated2013090)

kaible:

thiswouldgogreatwithsomerosemary:

junk-os:

sometimes your 13-year old self teach you things. good things.

re blogging for the artists that follow me

This is something I had an exact realization about at one point that still haunts me. In retrospect those drawings I did are nowhere near as good as I told myself they were, but I loved them and drew a lot more than I do now. Even if I’ve gotten better artistically, my inner critic has only gotten worse.

(via idiothair)

pancakesandplaid:

lokidindeed:

i-deduce-youre-a-bitch:

YOU NIQQAS WANNA LEARN ELVISH?! HERE YA GO!

this makes me think about the post about the two girls who didn’t want to get caught sendes notes in class so they learned elvish

im aware of this :) there’s another site that does this with a more detailed breakdown: http://www.starchamber.com/paracelsus/elvish/elvish-in-ten-minutes.html

(Source: cleocliche, via mangy-mongrel)

Seven Science Books of Stuff You Wish You’d Never Heard Of

I found Sam Kean’s “The violinist’s thumb” during one of my many genetics-related internet searches. The book sounded like a very nice read and so I started looking for more. However the search quickly went from “that’s nice to know”-books to “dear god why”-like stories.

So for your pleasure, a compilation of 7 books that start out innocent enough, but quickly digress into horrible diseases, deadly (and exploding) shrubs and the worst bugs you’ll ever find walking the face of the Earth.

More info on the reads:

Enjoy!

The people at the UC Davis Bioinformatics Core are gigantic nerds.

Precious.gigantic.nerds.

(I kind of want that shirt.)

Source: http://bioinformatics.ucdavis.edu/articles/bioinformatics-shirt-200908/

Where did that pigeon go?

Hi guys, I’m not dead yet!
In these past few weeks, I’ve been working hard on my internship. The downside: it’s 1.5 hours travelling by public transport between Utrecht and Harderwijk. By the time I’m home, I’m hungry, tired and then I still need to cook, clean and take care of my own administration. The laptop usually stays switched off. I already spend 8 hours behind that thing at my internship, so I usually don’t feel like doing so again by the time I’m home.
As a consequence, Tumblr-time has been suffering. (and IchiKai-time, Facebook-time, manga-reading-time, etc.)
And I don’t think it’ll become better in the near future. Because last weekend I moved house! I now temporarily live in Ermelo, which is only a 20 minute bike ride away from work. The little house I live in is beautiful and in the middle of the forest. 
But. 
It’s a vacation home. Aka: NO.INTERNET. 
I bought prepaid internet, but the USB adapter cannot pick up a stable 3G connection there. And 2G is kind of like having no internet. It feels nostalgic. Very 90-ies. 
Luckily there is a fast wifi connection at work so I try to do everything there, but I don’t have a lot of privacy and my Tumblr dash is not exactly SFW. 8D 
Alone-time at home is now spent reading Sherlock Holmes on the small terrace at the south side of the house. Or trying to determine that one funky species of grass that is growing in the lawn (botanist nerd-level reaching max. capacity). Or destroying the dandelions that are sprouting up everywhere. And most of all: listening to the birds. There are so many birds there, my god. At 5:10 AM, when the sun rises, the forest EXPLODES into mass bird-song. Kind of impossible to sleep through it, but beautiful nonetheless. (I bought ear-plugs anyway). 
Oh, and there is an amazingly large television there with HDMI access, so I can hook-up my laptop and blast Nine Inch Nails for a… change of pace. (No neighbours! Wooh!)
I’ll see if I can upload some pictures sometime. The Veluwe is an amazing nature reserve in the middle of the Netherlands. It’s one of the largest stretches of woodland in Europe and now I’m using it as a short-cut to get to the supermarket! Quite a difference from the industry terrain I normally live on in Utrecht.. 
My internship lasts until about the end of July. Maybe I’ll get some posts in when I run into something interesting on the web while I’m at work, but I don’t think I’ll be able to get back to a lot of comments, let alone stay up to date on what you guys are up to. :( 
So.. I miss you guys. You haven’t been forgotten. Once this internship is done and I’ve finished my Master’s, things’ll get back to normal (I hope). 
And now I have to get ready to get to seenisambol's b-day party. :D
Have a good weekend everyone (and happy Liberation day tomorrow for all you Dutchies out there!) and see you soon! 
-Dakduif.

Where did that pigeon go?

Hi guys, I’m not dead yet!

In these past few weeks, I’ve been working hard on my internship. The downside: it’s 1.5 hours travelling by public transport between Utrecht and Harderwijk. By the time I’m home, I’m hungry, tired and then I still need to cook, clean and take care of my own administration. The laptop usually stays switched off. I already spend 8 hours behind that thing at my internship, so I usually don’t feel like doing so again by the time I’m home.

As a consequence, Tumblr-time has been suffering. (and IchiKai-time, Facebook-time, manga-reading-time, etc.)

And I don’t think it’ll become better in the near future. Because last weekend I moved house! I now temporarily live in Ermelo, which is only a 20 minute bike ride away from work. The little house I live in is beautiful and in the middle of the forest.

But.

It’s a vacation home. Aka: NO.INTERNET.

I bought prepaid internet, but the USB adapter cannot pick up a stable 3G connection there. And 2G is kind of like having no internet. It feels nostalgic. Very 90-ies.

Luckily there is a fast wifi connection at work so I try to do everything there, but I don’t have a lot of privacy and my Tumblr dash is not exactly SFW. 8D

Alone-time at home is now spent reading Sherlock Holmes on the small terrace at the south side of the house. Or trying to determine that one funky species of grass that is growing in the lawn (botanist nerd-level reaching max. capacity). Or destroying the dandelions that are sprouting up everywhere. And most of all: listening to the birds. There are so many birds there, my god. At 5:10 AM, when the sun rises, the forest EXPLODES into mass bird-song. Kind of impossible to sleep through it, but beautiful nonetheless. (I bought ear-plugs anyway).

Oh, and there is an amazingly large television there with HDMI access, so I can hook-up my laptop and blast Nine Inch Nails for a… change of pace. (No neighbours! Wooh!)

I’ll see if I can upload some pictures sometime. The Veluwe is an amazing nature reserve in the middle of the Netherlands. It’s one of the largest stretches of woodland in Europe and now I’m using it as a short-cut to get to the supermarket! Quite a difference from the industry terrain I normally live on in Utrecht..

My internship lasts until about the end of July. Maybe I’ll get some posts in when I run into something interesting on the web while I’m at work, but I don’t think I’ll be able to get back to a lot of comments, let alone stay up to date on what you guys are up to. :(

So.. I miss you guys. You haven’t been forgotten. Once this internship is done and I’ve finished my Master’s, things’ll get back to normal (I hope).

And now I have to get ready to get to seenisambol's b-day party. :D

Have a good weekend everyone (and happy Liberation day tomorrow for all you Dutchies out there!) and see you soon!

-Dakduif.

(Source: Flickr / pawanpandey)

4 notes

amsterdamnedd:

voxify:

This must look so weird if you don’t speak Dutch
Honestly she’s just saying ‘mummy this one this one this one please’

i aM PISSING MYSELF

amsterdamnedd:

voxify:

This must look so weird if you don’t speak Dutch

Honestly she’s just saying ‘mummy this one this one this one please’

i aM PISSING MYSELF

(Source: archduckfranz, via officialdaddyegbert)

iamthedeadpool:

phoenixforce11:

blackskyline:

Oh, no big deal, it’s just the thing in Iron Man’s chest that is glowing in Loki’s eye.
Can you say AVENGERS!?
Sneaky, Marvel. Very sneaky.

WASGLKJASLDGIHAWOREEIHGL;KDSFJG
WHAT?!?!?!? O_o



*shits on everyone’s party* Ehrm, no its not. 
It’s probably the reflection from one of these things: http://fuzzcraft.com/pics/ringlight_6.jpg which is a ring light (DIY in this example). It is used a lot in photography because it gives very soft, equal lighting of the subject. 

But shirtless-Tony certainly works too. :)

iamthedeadpool:

phoenixforce11:

blackskyline:

Oh, no big deal, it’s just the thing in Iron Man’s chest that is glowing in Loki’s eye.

Can you say AVENGERS!?

Sneaky, Marvel. Very sneaky.

WASGLKJASLDGIHAWOREEIHGL;KDSFJG

WHAT?!?!?!? O_o

image

*shits on everyone’s party* Ehrm, no its not.

It’s probably the reflection from one of these things: http://fuzzcraft.com/pics/ringlight_6.jpg which is a ring light (DIY in this example). It is used a lot in photography because it gives very soft, equal lighting of the subject.

But shirtless-Tony certainly works too. :)

(Source: engagemachine, via mangy-mongrel)

mangy-mongrel replied to your link: TCATAGTTGTAAATATAGATAAACCGTTTGTAAAACCATATAATTTAGCATGAG

OMG I wanna work at your place HOWW

Haha! I know right? :P

Though slight context: it’s a small company with currently only 8 people working here (including myself), allowing for a lot of informal contact between employees.

Still, the managers are all 40-somethings with work experiences at larger companies, so this is still something that everyone face-palmed over when they saw the mail in their inbox. :’D

1 note

TCATAGTTGTAAATATAGATAAACCGTTTGTAAAACCATATAATTTAGCATGAG

Wait, what was that?

Just go to the above link, jot the DNA sequence into the top box, check the ‘DNA to text’ box and watch the message appear. :)

This is a translator tool that was sent around the company by the top management.

My internship place is being run by absolute nerds.

I’m in heaven.

wtffanfiction:

Fandom: BBC Sherlock
“‘Morning, Anderson,’ Sherlock said as he floated by. ‘Still haven’t evolved from a single-celled organism, I see. Pity, I know how badly you want to engage in meiosis with Donovan.’
Mycroft floated by and snapped at him, ‘No one appreciates you showing off your mitochondria, Sherlock, so why don’t you put it away.’
Sherlock rolled his eye-spot, then had a look at a dead bacterium that he was swimming past. ‘Bacteriophage, obviously,’ he said after a glance. ‘Bound itself to surface receptor molecules and then entered the cell. Within minutes, the polymerase had already begun translating viral mRNA into protein.’
Just then a paramecium drifted by. Only a single-celled organism, but he had plenty of cilia. One of the cilia looked to have been injured, and the pugnacious appearance of this paramecia suggested that it was a hard-won injury, and he was not one to be tangled with.
This could be very interesting indeed, Sherlock thought. So he drifted along side the paramecium for a while.”

wtffanfiction:

Fandom: BBC Sherlock

“‘Morning, Anderson,’ Sherlock said as he floated by. ‘Still haven’t evolved from a single-celled organism, I see. Pity, I know how badly you want to engage in meiosis with Donovan.’

Mycroft floated by and snapped at him, ‘No one appreciates you showing off your mitochondria, Sherlock, so why don’t you put it away.’

Sherlock rolled his eye-spot, then had a look at a dead bacterium that he was swimming past. ‘Bacteriophage, obviously,’ he said after a glance. ‘Bound itself to surface receptor molecules and then entered the cell. Within minutes, the polymerase had already begun translating viral mRNA into protein.’

Just then a paramecium drifted by. Only a single-celled organism, but he had plenty of cilia. One of the cilia looked to have been injured, and the pugnacious appearance of this paramecia suggested that it was a hard-won injury, and he was not one to be tangled with.

This could be very interesting indeed, Sherlock thought. So he drifted along side the paramecium for a while.”

(via mangy-mongrel)

Untitled: Drug Companies Pay to Delay Generics

laboratoryequipment:

Federal regulators are pressing the Supreme Court to stop big pharmaceutical corporations from paying generic drug competitors to delay releasing their cheaper versions of brand-name drugs. They argue these deals deny American consumers, usually for years, steep price…